pBAC-ie1-DsRed-ObirOrco-QF2-15xQUAS-GCaMP6s
(Plasmid #200400)

• Purpose: Expresses DsRed broadly, expresses QF2 and GCaMP6s in OSNs of the clonal raider ant
• Depositing Lab: Daniel Kronauer
• Publication: Hart et al Cell. 2023 Jul 6;186(14):3079-3094.e17. doi: 10.1016/j.cell.2023.05.025. Epub 2023 Jun 14.

Backbone

• Vector backbone: pXL-BACII-DsRed
• Backbone manufacturer: Potter Lab
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 12025
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Discosoma red fluorescent protein
• Alt name: DsRed
• Species: Discosoma sp.
• Insert Size (bp): 678
• Promoter: ie1 (baculovirus)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCTGCAGAACACGCAGCTAG
• 3′ sequencing primer: CCCTCCATGCGCACCTT

Gene/Insert 2

• Gene/Insert name: Q factor 2
• Alt name: QF2
• Species: Neurospora crassa
• Insert Size (bp): 1056
• Promoter: ObirOrco (Oocearaea biroi Orco promoter/enhancer fragment)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GATGCAGAAGAAGACCATG
• 3′ sequencing primer: CCTGATAAGTGCAGGAC

Gene/Insert 3

• Gene/Insert name: GCaMP6s
• Alt name: GCaMP3-K78H T302L R303P D380Y T381R S383T R392G
• Alt name: GCaMP3 variant 641
• Species: R. norvegicus (rat), G. gallus (chicken); ; A. victoria (jellyfish)
• Insert Size (bp): 1353
• Promoter: 15x QUAS

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCTAAACAATCTGCAGTAAAG
• 3′ sequencing primer: CATGTTCTACTTACGTGATAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: ie1 was cloned from Zach Adelman (Addgene #52894); DsRed & QF2 from Chris Potter (Addgene #104877); 15xQUAS from Chris Potter (Addgene #104875); GCaMP6s from Douglas Kim and GENIE Project (Addgene #40753)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry