pIA036
(Plasmid
#200425)
-
PurposeamyE::(Ppen-lacIΔ11-bsdronPA cm). PALM integration vector includes codon optimized dronPA fusion tagged C-terminal of LacI for FROS imaging in B. subtilis.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200425 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepIA034
- Backbone size w/o insert (bp) 7007
- Total vector size (bp) 8300
-
Vector typeBacterial Expression
-
Selectable markersChloramphenicol
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsE. coli: 37°C and selection Ampicillin 100 μg/mL B. subtilis: 30°C and selection Chloramphenicol 5 μg/mL
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameLacI
-
SpeciesEscherichia coli
-
Insert Size (bp)1047
-
GenBank IDJ01636.1
- Promoter Ppen
-
Tag
/ Fusion Protein
- bsdronPA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGAATTCGAGCTCGGTACGGGGATCGGGTTATCGAATTCCCGGTGG
- 3′ sequencing primer TTATGACTGACATGGCGGCCGCCAGCTGCATTAATGAATCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pPT300 was amplified using primers oIA027 and oIA069. The resulting fragment was cloned into pIA034 digested with BamHI and NotI, giving pIA036, amyE::(Ppen-lacIΔ11-bsdronPA cm).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIA036 was a gift from Rut Carballido-López (Addgene plasmid # 200425 ; http://n2t.net/addgene:200425 ; RRID:Addgene_200425) -
For your References section:
New PALM-compatible integration vectors for use in the Gram-positive model bacterium Bacillus subtilis. Altinoglu I, Carballido-Lopez R. bioRxiv 2023 10.1101/2023.03.16.532899