pMC-Dest-BsaI
(Plasmid
#200550)
-
Purpose(Empty Backbone) Mini circle destination vector with BsaI sites for Golden Gate Assembly
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200550 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMC BESPX- MCS2
-
Backbone manufacturerSystem Biosciences
- Backbone size (bp) 4006
-
Modifications to backboneModified MCS2 to contain 2 BsaI sites. Modified MCS2 as follows (SpeI)-EcoRI-BsaI-ClaI-NheI-SacI-BsaI-SalI- (ApaI). Original MCS2 90bp, modified 69bp.
-
Vector typeMinicircle Cloning Vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Gateway Cloning
- 3′ sequencing primer tcgccttcttgacgagttct
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMC-Dest-BsaI was a gift from Junsu Kang (Addgene plasmid # 200550 ; http://n2t.net/addgene:200550 ; RRID:Addgene_200550)