pCW57.1-Neurod1-3xT7
(Plasmid
#200890)
-
PurposeInducible lentiviral expression of Neurod1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200890 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCW57.1
- Backbone size w/o insert (bp) 9354
- Total vector size (bp) 10563
-
Vector typeMammalian Expression, Lentiviral ; Doxycycline inducible
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNeurod1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1209
-
Entrez GeneNeurod1 (a.k.a. BETA2, BHF-1, Nd1, Neurod, bHLHa3)
- Promoter TRE promoter, Tet ON
-
Tag
/ Fusion Protein
- 3xT7 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site HpaI (unknown if destroyed)
- 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
- 3′ sequencing primer GAACGGACGTGAAGAATGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57.1-Neurod1-3xT7 was a gift from Kai Ge (Addgene plasmid # 200890 ; http://n2t.net/addgene:200890 ; RRID:Addgene_200890) -
For your References section:
MLL3/MLL4 methyltransferase activities control early embryonic development and embryonic stem cell differentiation in a lineage-selective manner. Xie G, Lee JE, Senft AD, Park YK, Jang Y, Chakraborty S, Thompson JJ, McKernan K, Liu C, Macfarlan TS, Rocha PP, Peng W, Ge K. Nat Genet. 2023 Apr 3. doi: 10.1038/s41588-023-01356-4. 10.1038/s41588-023-01356-4 PubMed 37012455