M2e-noro-VLP
(Plasmid
#201192)
-
PurposeExpresses noro-VLP decorated with influenza M2e in insect cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201192 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepOET5.1
-
Backbone manufacturerOxford Expression Technologies
- Backbone size w/o insert (bp) 4573
- Total vector size (bp) 6258
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameM2e-noro-VLP
-
Alt nameNoro-M2e
-
SpeciesH. sapiens (human); Human norovirus, Human influenza virus
-
Insert Size (bp)1685
-
GenBank IDAFV08795
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- Influenza M2e peptide (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer taagtattttactgttttcgtaacagttttgtaataaaaaaacct
- 3′ sequencing primer agaatctagcgcttaataaatgtactaataacaatgtatcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byGene synthesis and subcloning was done as service at Genscript, USA.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
M2e-noro-VLP was a gift from Vesa Hytönen (Addgene plasmid # 201192 ; http://n2t.net/addgene:201192 ; RRID:Addgene_201192)