Skip to main content

pCMV- δLight
(Plasmid #201224)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201224 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 3988
  • Total vector size (bp) 6142
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    δLight1.3
  • Alt name
    deltaLight1.3
  • Species
    Synthetic
  • Insert Size (bp)
    2154
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ggtaggcgtgtacggtggg
  • 3′ sequencing primer gctattgctttatttgtaaccattataagctgcaataaac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV- δLight was a gift from Lin Tian (Addgene plasmid # 201224 ; http://n2t.net/addgene:201224 ; RRID:Addgene_201224)
  • For your References section:

    Unlocking opioid neuropeptide dynamics with genetically encoded biosensors. Dong C, Gowrishankar R, Jin Y, He XJ, Gupta A, Wang H, Sayar-Atasoy N, Flores RJ, Mahe K, Tjahjono N, Liang R, Marley A, Or Mizuno G, Lo DK, Sun Q, Whistler JL, Li B, Gomes I, Von Zastrow M, Tejeda HA, Atasoy D, Devi LA, Bruchas MR, Banghart MR, Tian L. Nat Neurosci. 2024 Jul 15. doi: 10.1038/s41593-024-01697-1. 10.1038/s41593-024-01697-1 PubMed 39009835