Skip to main content
Addgene

pet28b_His_RAD23A-UBA1
(Plasmid #201549)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201549 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-28b(+)
  • Backbone manufacturer
    Novagen
  • Total vector size (bp) 5477
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    UV excision repair protein RAD23 homolog A
  • Species
    H. sapiens (human)
  • Mutation
    Expresses amino acids 160-205 of DNA polymerase iota. Coding sequence has been optimised for expression in E. coli
  • Entrez Gene
    RAD23A (a.k.a. HHR23A, HR23A)
  • Promoter T7
  • Tag / Fusion Protein
    • 6x His (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pet28b_His_RAD23A-UBA1 was a gift from Roger Woodgate (Addgene plasmid # 201549 ; http://n2t.net/addgene:201549 ; RRID:Addgene_201549)
  • For your References section:

    A novel interaction between RAD23A/B and Y-family DNA polymerases. Ashton NW, Jaiswal N, Cestari Moreno N, Semenova IV, D'Orlando DA, Teatin Latancia M, McIntyre J, Woodgate R, Bezsonova I. J Mol Biol. 2023 Nov 5:168353. doi: 10.1016/j.jmb.2023.168353. 10.1016/j.jmb.2023.168353 PubMed 37935254