pet28b_His_RAD23A-UBA1
(Plasmid
#201549)
-
PurposeExpresses UBA1 of human RAD23A in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201549 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-28b(+)
-
Backbone manufacturerNovagen
- Total vector size (bp) 5477
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUV excision repair protein RAD23 homolog A
-
SpeciesH. sapiens (human)
-
MutationExpresses amino acids 160-205 of DNA polymerase iota. Coding sequence has been optimised for expression in E. coli
-
Entrez GeneRAD23A (a.k.a. HHR23A, HR23A)
- Promoter T7
-
Tag
/ Fusion Protein
- 6x His (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pet28b_His_RAD23A-UBA1 was a gift from Roger Woodgate (Addgene plasmid # 201549 ; http://n2t.net/addgene:201549 ; RRID:Addgene_201549) -
For your References section:
A novel interaction between RAD23A/B and Y-family DNA polymerases. Ashton NW, Jaiswal N, Cestari Moreno N, Semenova IV, D'Orlando DA, Teatin Latancia M, McIntyre J, Woodgate R, Bezsonova I. J Mol Biol. 2023 Nov 5:168353. doi: 10.1016/j.jmb.2023.168353. 10.1016/j.jmb.2023.168353 PubMed 37935254