pGS775
(Plasmid
#20169)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 20169 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepT7-7
-
Backbone manufacturermade by S Tabor/sold by USB
- Backbone size w/o insert (bp) 2743
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsrecommended expression strain BL21 (DE3) pLysS
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRuvC
-
SpeciesE. coli
-
Insert Size (bp)512
-
Mutationnone
-
GenBank IDCAA42128
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ggcctgctagaattcaaaaaggaggcgcgtgatg
- 3′ sequencing primer ggagtggaaaagcttcagccgg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGreg Sharples
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGS775 was a gift from Stephen West (Addgene plasmid # 20169 ; http://n2t.net/addgene:20169 ; RRID:Addgene_20169) -
For your References section:
Cloning, overexpression, purification, and characterization of the Escherichia coli RuvC Holliday junction resolvase. Dunderdale HJ, Sharples GJ, Lloyd RG, West SC. J Biol Chem. 1994 Feb 18. 269(7):5187-94. PubMed 8106500