Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pET_RTX-6xHis
(Plasmid #145029)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 145029 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    modified pET21
  • Backbone size w/o insert (bp) 5871
  • Total vector size (bp) 8232
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RTX
  • Alt name
    Reverse Transcription Xenopolymerase
  • Species
    Synthetic
  • Insert Size (bp)
    2361
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GATCTCGATCCCGCGAAATTAATACGAC
  • 3′ sequencing primer TTGCTCAGCGGTGGCAGCAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Jared Ellefson (Ellington Lab)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note: Addgene’s first pass of QC with Sanger sequencing was unable to cover the region containing the N210DL mutation in RTX.

Please visit https://doi.org/10.1101/2020.03.29.013342 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET_RTX-6xHis was a gift from Andrew Ellington (Addgene plasmid # 145029 ; http://n2t.net/addgene:145029 ; RRID:Addgene_145029)
  • For your References section:

    A one-enzyme RT-qPCR assay for SARS-CoV-2, and procedures for reagent production. Bhadra S, Maranhao AC, Paik I, Ellington AD. BioProtocol 2021 10.21769/BioProtoc.3898