Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAtetO_6xHis-Bst-LF
(Plasmid #145799)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 145799 Standard format: Plasmid sent in bacteria as agar stab 1 $75 *

* Login to view industry pricing.

Backbone

  • Vector backbone
    pAtetO
  • Backbone manufacturer
    modified from pASK-IBA37plus (IBA GmbH)
  • Modifications to backbone
    Removal of 6xHis tag, multiple cloning site, and Rop gene from pASK-IBA37plus
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Bst-LF
  • Alt name
    Large-fragment Bst DNAP
  • Alt name
    Bst(exo-)
  • Species
    Geobacillus stearothermophilus
  • Insert Size (bp)
    1827
  • Promoter tet PA
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TACAGACCCTAATTTCACATCATATGAC
  • 3′ sequencing primer CCGACGAACTAAAACGCTTGAGGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAtetO_6xHis-Bst-LF was a gift from Andrew Ellington (Addgene plasmid # 145799 ; http://n2t.net/addgene:145799 ; RRID:Addgene_145799)
  • For your References section:

    High-surety isothermal amplification and detection of SARS-CoV-2, including with crude enzymes. Bhadra S, Riedel TE, Lakhotia S, Tran ND, Ellington AD. bioRxiv 2020.04.13.039941 10.1101/2020.04.13.039941