HRE-UnaG
              
              
                (Plasmid
                
                #201710)
              
            
            
            
          - 
            PurposeHypoxia responsive promoter driving UnaG fluorescent proteins
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201710 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepEF/myc/cyto
- 
              Vector typeMammalian Expression
- 
                Selectable markersNeomycin (select with G418)
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameUnaG
- Promoter HRE-mCMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCACATTTCCCCGAAAAGTGC
- 3′ sequencing primer CACGGGGGAGGGGCAAACAAC (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: HRE-UnaG was a gift from Friedemann Kiefer (Addgene plasmid # 201710 ; http://n2t.net/addgene:201710 ; RRID:Addgene_201710)
- 
                For your References section: A novel family of fluorescent hypoxia sensors reveal strong heterogeneity in tumor hypoxia at the cellular level. Erapaneedi R, Belousov VV, Schafers M, Kiefer F. EMBO J. 2016 Jan 4;35(1):102-13. doi: 10.15252/embj.201592775. Epub 2015 Nov 23. 10.15252/embj.201592775 PubMed 26598532
