pLenti-HRE-dUnaG
(Plasmid #124372)

• Purpose: UnaG fluorescent protein reporter for hypoxia-induced factor (HIF) signaling
• Depositing Lab: Roland Friedel
• Publication: Sattiraju et al Immunity. 2023 Jul 7:S1074-7613(23)00274-1. doi: 10.1016/j.immuni.2023.06.017.

Backbone

• Vector backbone: pLenti X1 Puro DEST (Addgene #17297)
• Backbone manufacturer: Eric Campeau & Paul Kaufman
• Backbone size w/o insert (bp): 9031
• Total vector size (bp): 8646
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HRE-dUnaG
• Species: Anguilla japonica
• Insert Size (bp): 1300
• Promoter: HRE (HIF responsive element 5x + CMV minimal promoter)
• Tag / Fusion Protein:
  • PEST-degron and Myc tag (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: Primer 1 CACCGTACCGAGCTTTTCTCGAGC
• 3′ sequencing primer: Primer 2 CAGCTGGTTCTTTCCGCCTC

Resource Information

• Supplemental Documents:
  • pLenti-HRE-dUnaG.gbk
• A portion of this plasmid was derived from a plasmid made by: the HRE-UnaG insert was obtained from a plasmid that we received with an MTA from the Max-Planck Institute Münster, Germany

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2022.03.01.482530 for bioRxiv preprint.