HRE-UnaG
(Plasmid
#201710)
-
PurposeHypoxia responsive promoter driving UnaG fluorescent proteins
-
Depositing Lab
-
Depositing OrganizationUniversitaetsklinikum Muenster
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201710 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 201710-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 201710-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEF/myc/cyto
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUnaG
- Promoter HRE-mCMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCACATTTCCCCGAAAAGTGC
- 3′ sequencing primer CACGGGGGAGGGGCAAACAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 201710-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 201710-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HRE-UnaG was a gift from Friedemann Kiefer (Addgene plasmid # 201710 ; http://n2t.net/addgene:201710 ; RRID:Addgene_201710) -
For your References section:
A novel family of fluorescent hypoxia sensors reveal strong heterogeneity in tumor hypoxia at the cellular level. Erapaneedi R, Belousov VV, Schafers M, Kiefer F. EMBO J. 2016 Jan 4;35(1):102-13. doi: 10.15252/embj.201592775. Epub 2015 Nov 23. 10.15252/embj.201592775 PubMed 26598532