pOPINVHH_A8_His
(Plasmid
#201718)
-
PurposeExpression of nanobody
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201718 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepADL-23c
-
Backbone manufacturerAntibody Design Laboratories
- Backbone size w/o insert (bp) 3960
- Total vector size (bp) 4345
-
Modifications to backboneIntroduction of restriction sites for cloning
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVHH_A8
-
Specieslama glama (llama)
-
Insert Size (bp)375
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
-
Tag
/ Fusion Protein
- Hexahistidine (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCTTCCGGCTCGTATGTTG
- 3′ sequencing primer GTCGTCTTTCCAGACGTTAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOPINVHH_A8_His was a gift from Ray Owens (Addgene plasmid # 201718 ; http://n2t.net/addgene:201718 ; RRID:Addgene_201718) -
For your References section:
Structural and functional characterization of nanobodies that neutralize Omicron variants of SARS-CoV-2. Cornish K, Huo J, Jones L, Sharma P, Thrush JW, Abdelkarim S, Kipar A, Ramadurai S, Weckener M, Mikolajek H, Liu S, Buckle I, Bentley E, Kirby A, Han X, Laidlaw SM, Hill M, Eyssen L, Norman C, Le Bas A, Clarke J, James W, Stewart JP, Carroll M, Naismith JH, Owens RJ. Open Biol. 2024 Jun;14(6):230252. doi: 10.1098/rsob.230252. Epub 2024 Jun 4. 10.1098/rsob.230252 PubMed 38835241