Skip to main content

pOPINVHH_A8_His
(Plasmid #201718)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201718 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pADL-23c
  • Backbone manufacturer
    Antibody Design Laboratories
  • Backbone size w/o insert (bp) 3960
  • Total vector size (bp) 4345
  • Modifications to backbone
    Introduction of restriction sites for cloning
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    VHH_A8
  • Species
    lama glama (llama)
  • Insert Size (bp)
    375
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Tag / Fusion Protein
    • Hexahistidine (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GCTTCCGGCTCGTATGTTG
  • 3′ sequencing primer GTCGTCTTTCCAGACGTTAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOPINVHH_A8_His was a gift from Ray Owens (Addgene plasmid # 201718 ; http://n2t.net/addgene:201718 ; RRID:Addgene_201718)
  • For your References section:

    Structural and functional characterization of nanobodies that neutralize Omicron variants of SARS-CoV-2. Cornish K, Huo J, Jones L, Sharma P, Thrush JW, Abdelkarim S, Kipar A, Ramadurai S, Weckener M, Mikolajek H, Liu S, Buckle I, Bentley E, Kirby A, Han X, Laidlaw SM, Hill M, Eyssen L, Norman C, Le Bas A, Clarke J, James W, Stewart JP, Carroll M, Naismith JH, Owens RJ. Open Biol. 2024 Jun;14(6):230252. doi: 10.1098/rsob.230252. Epub 2024 Jun 4. 10.1098/rsob.230252 PubMed 38835241