Skip to main content

pJRH-1180 U6-reci Gag-pol v2
(Plasmid #201915)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201915 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    psPax2, Addgene Plasmid #12260
  • Total vector size (bp) 11171
  • Modifications to backbone
    psPax2 (Addgene plasmid #12260) was first modified to remove a SalI restriction site 3' of the gag-pol transgene. The U6-sgRNA expression cassette was amplified from Addgene plasmid #171625 and inserted into the modified, SalI-digested psPax2 with InFusion cloning (Takara Bio).
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Gag-pol
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCTAGAGCCTCTGCTAACC
  • 3′ sequencing primer GCCAGAAGTCAGATGCTCAAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJRH-1180 U6-reci Gag-pol v2 was a gift from Jennifer Doudna (Addgene plasmid # 201915 ; http://n2t.net/addgene:201915 ; RRID:Addgene_201915)
  • For your References section:

    In vivo human T cell engineering with enveloped delivery vehicles. Hamilton JR, Chen E, Perez BS, Sandoval Espinoza CR, Kang MH, Trinidad M, Ngo W, Doudna JA. Nat Biotechnol. 2024 Jan 11. doi: 10.1038/s41587-023-02085-z. 10.1038/s41587-023-02085-z PubMed 38212493