Skip to main content

pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
(Plasmid #201916)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201916 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Addgene Plasmid #201914
  • Total vector size (bp) 11200
  • Modifications to backbone
    Annealed oligos were ligated and annealed into BsmBI-digested vector (Addgene Plasmid #201914) for B2M sgRNA cloning.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Gag-Cas9 v2
  • Promoter CAG

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCTAGAGCCTCTGCTAACC
  • 3′ sequencing primer GCCAGAAGTCAGATGCTCAAGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
  • Promoter Human U6

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer GAGGGCCTATTTCCCATGATT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2 was a gift from Jennifer Doudna (Addgene plasmid # 201916 ; http://n2t.net/addgene:201916 ; RRID:Addgene_201916)
  • For your References section:

    In vivo human T cell engineering with enveloped delivery vehicles. Hamilton JR, Chen E, Perez BS, Sandoval Espinoza CR, Kang MH, Trinidad M, Ngo W, Doudna JA. Nat Biotechnol. 2024 Jan 11. doi: 10.1038/s41587-023-02085-z. 10.1038/s41587-023-02085-z PubMed 38212493