Skip to main content

pegRNA_HEK4_1bp-insertion
(Plasmid #201977)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201977 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pmd127 pLKO.1
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pegRNA_HEK4_1bp-insertion
  • gRNA/shRNA sequence
    GGCACTGCGGCTGGAGGTGG

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pegRNA_HEK4_1bp-insertion was a gift from Scot Wolfe (Addgene plasmid # 201977 ; http://n2t.net/addgene:201977 ; RRID:Addgene_201977)
  • For your References section:

    Genome-wide profiling of prime editor off-target sites in vitro and in vivo using PE-tag. Liang SQ, Liu P, Ponnienselvan K, Suresh S, Chen Z, Kramme C, Chatterjee P, Zhu LJ, Sontheimer EJ, Xue W, Wolfe SA. Nat Methods. 2023 Jun;20(6):898-907. doi: 10.1038/s41592-023-01859-2. Epub 2023 May 8. 10.1038/s41592-023-01859-2 PubMed 37156841