pEGFP-C1-GAP1IP4BPdeltaC2
(Plasmid
#20199)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 20199 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4731
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGAP1IP4BP-detlaC2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1662
-
MutationDeletion of C2 domains
-
Entrez GeneRASA3 (a.k.a. GAP1IP4BP, GAPIII)
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GATCACATGGTCCTGCTGGAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C1-GAP1IP4BPdeltaC2 was a gift from Robin Irvine (Addgene plasmid # 20199 ; http://n2t.net/addgene:20199 ; RRID:Addgene_20199) -
For your References section:
Reversible binding and rapid diffusion of proteins in complex with inositol lipids serves to coordinate free movement with spatial information. Hammond GR, Sim Y, Lagnado L, Irvine RF. J Cell Biol. 2009 Jan 26;184(2):297-308. doi: 10.1083/jcb.200809073. Epub 2009 Jan 19. 10.1083/jcb.200809073 PubMed 19153221