Skip to main content

pEGFP-C1-GAP1IP4BPdeltaC2
(Plasmid #20199)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 20199 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GAP1IP4BP-detlaC2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1662
  • Mutation
    Deletion of C2 domains
  • Entrez Gene
    RASA3 (a.k.a. GAP1IP4BP, GAPIII)
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer GATCACATGGTCCTGCTGGAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C1-GAP1IP4BPdeltaC2 was a gift from Robin Irvine (Addgene plasmid # 20199 ; http://n2t.net/addgene:20199 ; RRID:Addgene_20199)
  • For your References section:

    Reversible binding and rapid diffusion of proteins in complex with inositol lipids serves to coordinate free movement with spatial information. Hammond GR, Sim Y, Lagnado L, Irvine RF. J Cell Biol. 2009 Jan 26;184(2):297-308. doi: 10.1083/jcb.200809073. Epub 2009 Jan 19. 10.1083/jcb.200809073 PubMed 19153221