Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP-C1-PH-GAP1IP4BP
(Plasmid #20200)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 20200 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PH-GAP1IP4BP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    408
  • Mutation
    Isolated PH/Btk domain
  • GenBank ID
    RASA3
  • Entrez Gene
    RASA3 (a.k.a. GAP1IP4BP, GAPIII)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer GATCACATGGTCCTGCTGGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-C1-PH-GAP1IP4BP was a gift from Robin Irvine (Addgene plasmid # 20200 ; http://n2t.net/addgene:20200 ; RRID:Addgene_20200)
  • For your References section:

    Reversible binding and rapid diffusion of proteins in complex with inositol lipids serves to coordinate free movement with spatial information. Hammond GR, Sim Y, Lagnado L, Irvine RF. J Cell Biol. 2009 Jan 19. ():. 10.1083/jcb.200809073 PubMed 19153221