pJYP1
(Plasmid
#202406)
-
Purpose(Empty Backbone) Backbone vector to clone toxic or unstable DNA using dual-control (transcriptional control via naringenin inducible pfdeA promoter - translational control via B12 riboswitch)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202406 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET22b
-
Modifications to backboneThe pET22b expression vector was modified by inserting the fdeR transcriptional activator and promoter operator region (PfdeA – fdeO) followed by a vitamin B12 riboswitch (RSB12) into the HpaI and XhoI site. The resulting pJYP1 vector contains a BglII restriction site downstream of the riboswitch to allow toxin cloning.
-
Vector typeBacterial Expression
- Promoter fdeA
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Cloning Information
- 5′ sequencing primer CATAAGGACAGGAGAGCGTTC
- 3′ sequencing primer GCGAAAATCCTGTTTGATGGTGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJYP1 was a gift from Remy Loris (Addgene plasmid # 202406 ; http://n2t.net/addgene:202406 ; RRID:Addgene_202406) -
For your References section:
A Multi-Layer-Controlled Strategy for Cloning and Expression of Toxin Genes in Escherichia coli. Vandierendonck J, Girardin Y, De Bruyn P, De Greve H, Loris R. Toxins (Basel). 2023 Aug 18;15(8):508. doi: 10.3390/toxins15080508. 10.3390/toxins15080508 PubMed 37624265