pCAGGS-SMS1-TEV-Twin-Strep
(Plasmid #202528)

• Purpose: Express C-terminal Tobacco Etch Virus (TEV) protease cleavable Twin-Strep-tagged human Sphingomyelin synthase 1 (SMS1) in mammalian cell
• Depositing Lab: Chiaki Murakami
• Publication: Furuta et al FEBS Open Bio. 2023 May 11. doi: 10.1002/2211-5463.13628.

Backbone

• Vector backbone: pCAGGS-N-TEV-Twin-Strep
• Backbone manufacturer: Chiaki Murakami
• Backbone size w/o insert (bp): 4871
• Total vector size (bp): 6102
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SGMS1
• Alt name: SMS1
• Alt name: Sphingomyelin synthase 1
• Species: H. sapiens (human)
• Insert Size (bp): 1239
• Mutation: deleted stop codon (TAA)
• GenBank ID: NM_147156.4 NM_147156.3
• Entrez Gene: SGMS1 (a.k.a. MOB, MOB1, SMS1, TMEM23, hmob33)
• Promoter: CAG
• Tags / Fusion Proteins:
  • Twin-Strep-tag (C terminal on backbone)
  • TEV cleavable site (C terminal on backbone)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTCGGCTTCTGGCGTGTGACC
• 3′ sequencing primer: TATTAGCCAGAAGTCAGATGCTCAAGG

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

I'm in the process of creating a protocol for expression and purification of the protein using this plasmid.