Skip to main content

pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
(Plasmid #202555)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202555 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV-hUV6-sgRNA-dCas9-KRAB-TagBFP
  • Backbone manufacturer
    Dr Konstantin Kogan
  • Backbone size w/o insert (bp) 14900
  • Total vector size (bp) 15002
  • Vector type
    Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG)
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    76
  • GenBank ID
    25716
  • Entrez Gene
    Syt1 (a.k.a. P65)
  • Tag / Fusion Protein
    • 3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr Konstantin Kogan from DNA Dream Lab (DDL) facility (HiLIFE, Institute of Biotechnology, Helsinki, Finland).

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246) was a gift from Frederic Meunier (Addgene plasmid # 202555 ; http://n2t.net/addgene:202555 ; RRID:Addgene_202555)
  • For your References section:

    Presynaptic targeting of botulinum neurotoxin type A requires a tripartite PSG-Syt1-SV2 plasma membrane nanocluster for synaptic vesicle entry. Joensuu M, Syed P, Saber SH, Lanoue V, Wallis TP, Rae J, Blum A, Gormal RS, Small C, Sanders S, Jiang A, Mahrhold S, Krez N, Cousin MA, Cooper-White R, Cooper-White JJ, Collins BM, Parton RG, Balistreri G, Rummel A, Meunier FA. EMBO J. 2023 Jul 3;42(13):e112095. doi: 10.15252/embj.2022112095. Epub 2023 May 25. 10.15252/embj.2022112095 PubMed 37226896