pcDNA3.1/Puro-CAG-JEDI-1P-P2A-mCherry-CAAX
(Plasmid
#202606)
-
PurposeGenetically encoded voltage indicator (GEVI) JEDI-1P fused to membrane-anchored mCherry via P2A, expressed under strong mammalian promoter (CAG)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202606 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1/Puro-CAG
- Backbone size w/o insert (bp) 6088
- Total vector size (bp) 8212
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameJEDI-1P-P2A-mCherry-CAAX
-
SpeciesSynthetic
-
Insert Size (bp)2124
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer AAGGTGGTGGCTGGTGTGGC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.08.29.505018 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1/Puro-CAG-JEDI-1P-P2A-mCherry-CAAX was a gift from Francois St-Pierre (Addgene plasmid # 202606 ; http://n2t.net/addgene:202606 ; RRID:Addgene_202606) -
For your References section:
Widefield imaging of rapid pan-cortical voltage dynamics with an indicator evolved for one-photon microscopy. Lu X, Wang Y, Liu Z, Gou Y, Jaeger D, St-Pierre F. Nat Commun. 2023 Oct 12;14(1):6423. doi: 10.1038/s41467-023-41975-3. 10.1038/s41467-023-41975-3 PubMed 37828037