pJFRC7-JEDI-1P
(Plasmid
#202618)
-
PurposeGenetically encoded voltage indicator (GEVI) JEDI-1P under the promoter hsp70 for Drosophila (insect) expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202618 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJFRC7
- Backbone size w/o insert (bp) 8151
- Total vector size (bp) 9438
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameJEDI-1P
-
SpeciesSynthetic
-
Insert Size (bp)1287
- Promoter hsp70
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GAGCGCCGGAGTATAAATAGAG
- 3′ sequencing primer CCATTCATCAGTTCCATAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.08.29.505018 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJFRC7-JEDI-1P was a gift from Francois St-Pierre (Addgene plasmid # 202618 ; http://n2t.net/addgene:202618 ; RRID:Addgene_202618) -
For your References section:
Widefield imaging of rapid pan-cortical voltage dynamics with an indicator evolved for one-photon microscopy. Lu X, Wang Y, Liu Z, Gou Y, Jaeger D, St-Pierre F. Nat Commun. 2023 Oct 12;14(1):6423. doi: 10.1038/s41467-023-41975-3. 10.1038/s41467-023-41975-3 PubMed 37828037