Skip to main content

P789_pY026_EnAsCpf1_CLYBL_T1_catRNA
(Plasmid #202760)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202760 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 4963
  • Total vector size (bp) 9767
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    huAsCpf1
  • gRNA/shRNA sequence
    ACTTCCTTACTGTTAACTTCCATA
  • Species
    Synthetic
  • Promoter CMV

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Zhang Lab (Addgene Plasmid #84741)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    P789_pY026_EnAsCpf1_CLYBL_T1_catRNA was a gift from Karl Wahlin (Addgene plasmid # 202760 ; http://n2t.net/addgene:202760 ; RRID:Addgene_202760)
  • For your References section:

    Human retinal ganglion cell neurons generated by synchronous BMP inhibition and transcription factor mediated reprogramming. Agarwal D, Dash N, Mazo KW, Chopra M, Avila MP, Patel A, Wong RM, Jia C, Do H, Cheng J, Chiang C, Jurlina SL, Roshan M, Perry MW, Rho JM, Broyer R, Lee CD, Weinreb RN, Gavrilovici C, Oesch NW, Welsbie DS, Wahlin KJ. NPJ Regen Med. 2023 Sep 29;8(1):55. doi: 10.1038/s41536-023-00327-x. 10.1038/s41536-023-00327-x PubMed 37773257