Skip to main content
Addgene

pSLQ9713: pHR-PGK-SV40_NLS-dCasMINI-V4-QNZF-c-Myc_NLS-mCherry-WPRE
(Plasmid #203219)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 203219 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHR
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    dCasMINI-V4-QNZF-mCherry
  • Promoter PGK

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAAAAGCGCACGTCTGCCGC
  • 3′ sequencing primer GATACAAAGGCATTAAAGCAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ9713: pHR-PGK-SV40_NLS-dCasMINI-V4-QNZF-c-Myc_NLS-mCherry-WPRE was a gift from Stanley Qi (Addgene plasmid # 203219 ; http://n2t.net/addgene:203219 ; RRID:Addgene_203219)
  • For your References section:

    Development of compact transcriptional effectors using high-throughput measurements in diverse contexts. Tycko J, Van MV, Aradhana, DelRosso N, Ye H, Yao D, Valbuena R, Vaughan-Jackson A, Xu X, Ludwig C, Spees K, Liu K, Gu M, Khare V, Mukund AX, Suzuki PH, Arana S, Zhang C, Du PP, Ornstein TS, Hess GT, Kamber RA, Qi LS, Khalil AS, Bintu L, Bassik MC. Nat Biotechnol. 2024 Nov 1. doi: 10.1038/s41587-024-02442-6. 10.1038/s41587-024-02442-6 PubMed 39487265