His-DNPH1
(Plasmid
#203224)
-
PurposeFor protein expression. Human DNPH1 is an N-glycosidase with specificity toward 5-hydroxymethyl uridine monophosphate. Pet28a plasmid, KAN resistant, N-terminal TEV-cleavable 6xHis tag.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 203224 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepet28a
- Backbone size w/o insert (bp) 5237
- Total vector size (bp) 5801
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDNPH1
-
Alt namercl
-
Alt nameUniprot: O43598
-
SpeciesH. sapiens (human)
-
Insert Size (bp)564
-
Entrez GeneDNPH1 (a.k.a. C6orf108, RCL, dJ330M21.3)
- Promoter T7
-
Tag
/ Fusion Protein
- His tag (with TEV cleavage site) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGenscript
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
His-DNPH1 was a gift from Vern Schramm (Addgene plasmid # 203224 ; http://n2t.net/addgene:203224 ; RRID:Addgene_203224) -
For your References section:
An enzyme-coupled microplate assay for activity and inhibition of hmdUMP hydrolysis by DNPH1. Wagner AG, Eskandari R, Schramm VL. Anal Biochem. 2023 Jul 1;672:115171. doi: 10.1016/j.ab.2023.115171. Epub 2023 May 3. 10.1016/j.ab.2023.115171 PubMed 37142196