-
PurposeLentiviral plasmid expressing mouse Oct4, Sox2, Klf4 and cMyc for iPS cell generation
-
Depositing Lab
-
Depositing OrganizationWhitehead Institute for Biomedical Research
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 20328 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneFUW (Lenti-Lox-Ubi)
-
Backbone manufacturerhomemade
- Backbone size w/o insert (bp) 7222
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsTOP10, 37C
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOct4-P2A-Sox2-T2A-Klf4-E2A-cMyc
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)5000
-
Entrez GeneMyc (a.k.a. Myc2, Niard, Nird, bHLHe39)
-
Entrez GeneSox2 (a.k.a. Sox-2, lcc, ysb)
-
Entrez GenePou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)
-
Entrez GeneKlf4 (a.k.a. EZF, Gklf, Zie)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ACTTTGCAGCCTGAGGGCCA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUW-OSKM was a gift from Rudolf Jaenisch (Addgene plasmid # 20328 ; http://n2t.net/addgene:20328 ; RRID:Addgene_20328) -
For your References section:
Reprogramming of murine and human somatic cells using a single polycistronic vector. Carey BW, Markoulaki S, Hanna J, Saha K, Gao Q, Mitalipova M, Jaenisch R. Proc Natl Acad Sci U S A. 2009 Jan 6. 106(1):157-62. 10.1073/pnas.0811426106 PubMed 19109433