Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pStart-K
(Plasmid #20346)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 20346 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DB3.1
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    pStart-K
  • Species
    cloning vector
  • GenBank ID
    EU530620

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TAAACTGCCAGGCATCAAACTAAGC
  • 3′ sequencing primer AGTCAGCCCCATACGATATAAGTTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pStart-K was a gift from Mario Capecchi (Addgene plasmid # 20346 ; http://n2t.net/addgene:20346 ; RRID:Addgene_20346)
  • For your References section:

    A protocol for constructing gene targeting vectors: generating knockout mice for the cadherin family and beyond. Wu S, Ying G, Wu Q, Capecchi MR. Nat Protoc. 2008 . 3(6):1056-76. 10.1038/nprot.2008.70 PubMed 18546598