CSII-TK-MAIP1
(Plasmid
#203599)
-
PurposeLentiviral vector to express MAIP1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 203599 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneCSII-TK-MCS
- Backbone size w/o insert (bp) 5339
-
Modifications to backbone9000
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namematrix AAA peptidase interacting protein 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)774
-
MutationWT
-
GenBank IDNM_001369399.1
-
Entrez GeneMAIP1 (a.k.a. C2orf47)
- Promoter TK
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer CGGGTCATAAAAATGGCGCTGG
- 3′ sequencing primer AAGTCCATAAGCTGATTTTTCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CSII-TK-MAIP1 was a gift from Hiroyuki Mizuguchi (Addgene plasmid # 203599 ; http://n2t.net/addgene:203599 ; RRID:Addgene_203599) -
For your References section:
miR-27b targets MAIP1 to mediate lipid accumulation in cultured human and mouse hepatic cells. Sakai E, Imaizumi T, Suzuki R, Taracena-Gandara M, Fujimoto T, Sakurai F, Mizuguchi H. Commun Biol. 2023 Jun 24;6(1):669. doi: 10.1038/s42003-023-05049-w. 10.1038/s42003-023-05049-w PubMed 37355744