Skip to main content

psicheck2-MAIP1mut
(Plasmid #203604)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 203604 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    psicheck2
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 6273
  • Total vector size (bp) 6420
  • Modifications to backbone
    The 3'UTR (nt 1065-1235) of MAIP1 with mutated miR-27b target sequences was inserted between XhoI and NotI in psicheck2.
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    matrix AAA peptidase interacting protein 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    171
  • Mutation
    miR-27b target sequences in the 3'UTR was mutated
  • GenBank ID
    NM_001369399.1
  • Entrez Gene
    MAIP1 (a.k.a. C2orf47)
  • Promoter SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer gtggagcgcgtgctgaagaac
  • 3′ sequencing primer ccgcgaggtccgaagactc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psicheck2-MAIP1mut was a gift from Hiroyuki Mizuguchi (Addgene plasmid # 203604 ; http://n2t.net/addgene:203604 ; RRID:Addgene_203604)
  • For your References section:

    miR-27b targets MAIP1 to mediate lipid accumulation in cultured human and mouse hepatic cells. Sakai E, Imaizumi T, Suzuki R, Taracena-Gandara M, Fujimoto T, Sakurai F, Mizuguchi H. Commun Biol. 2023 Jun 24;6(1):669. doi: 10.1038/s42003-023-05049-w. 10.1038/s42003-023-05049-w PubMed 37355744