psicheck2-PHLPP2mut
(Plasmid
#203606)
-
PurposeReporter plasmid carrying PHLPP2 3'UTR with mutated miR-27b target sequences
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 203606 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepsicheck2
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6273
- Total vector size (bp) 7137
-
Modifications to backboneThe 3'UTR (nt 5074-5906) of PHLPP2 with mutated miR-27b target sequences was inserted between XhoI and NotI in psicheck2.
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePH domain and leucine rich repeat protein phosphatase 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)833
-
MutationmiR-27b target sequences in the 3'UTR were mutated
-
GenBank IDNM_001289003.1
-
Entrez GenePHLPP2 (a.k.a. PHLPPL, PPM3B)
- Promoter SV40
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer gtggagcgcgtgctgaagaac
- 3′ sequencing primer ccgcgaggtccgaagactc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psicheck2-PHLPP2mut was a gift from Hiroyuki Mizuguchi (Addgene plasmid # 203606 ; http://n2t.net/addgene:203606 ; RRID:Addgene_203606) -
For your References section:
miR-27b targets MAIP1 to mediate lipid accumulation in cultured human and mouse hepatic cells. Sakai E, Imaizumi T, Suzuki R, Taracena-Gandara M, Fujimoto T, Sakurai F, Mizuguchi H. Commun Biol. 2023 Jun 24;6(1):669. doi: 10.1038/s42003-023-05049-w. 10.1038/s42003-023-05049-w PubMed 37355744