VSVG-mCherry-RUSH
(Plasmid
#203647)
-
PurposeRUSH cargo: Str-KDEL_IRES_SBP-mCherry-VSVG
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 203647 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneOriginal RUSH construct (gift of F. Perezand G. Boncompain, Curie Institute; Boncompain et al., 2012, Nature Methods)
- Total vector size (bp) 6721
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVSVG
-
Alt nameVesicular stomatitus virus G protein
-
SpeciesVesicular stomatitis Indiana virus
-
Insert Size (bp)1488
-
GenBank IDNC_001560.1
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VSVG-mCherry-RUSH was a gift from Juan Bonifacino (Addgene plasmid # 203647 ; http://n2t.net/addgene:203647 ; RRID:Addgene_203647) -
For your References section:
Segregation in the Golgi complex precedes export of endolysosomal proteins in distinct transport carriers. Chen Y, Gershlick DC, Park SY, Bonifacino JS. J Cell Biol. 2017 Dec 4;216(12):4141-4151. doi: 10.1083/jcb.201707172. Epub 2017 Oct 4. 10.1083/jcb.201707172 PubMed 28978644