pSFFV_Gal4-VP64-IRES-mCherry (pLZA139)
(Plasmid
#203909)
-
PurposeEncodes wild type Gal4-VP64 transcription factor in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 203909 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
- Backbone size w/o insert (bp) 8953
- Total vector size (bp) 10888
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGal4-VP64-IRES-mCherry
-
SpeciesSynthetic
-
Insert Size (bp)1935
- Promoter SFFV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer atctggagctctcgagaattctcac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSFFV_Gal4-VP64-IRES-mCherry (pLZA139) was a gift from Jared Toettcher (Addgene plasmid # 203909 ; http://n2t.net/addgene:203909 ; RRID:Addgene_203909) -
For your References section:
Light-switchable transcription factors obtained by direct screening in mammalian cells. Zhu L, McNamara HM, Toettcher JE. Nat Commun. 2023 Jun 2;14(1):3185. doi: 10.1038/s41467-023-38993-6. 10.1038/s41467-023-38993-6 PubMed 37268649