Skip to main content

pRC-CMV-Rev1b
(Plasmid #204153)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204153 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRC
  • Total vector size (bp) 5898
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rev
  • Species
    HIV-1
  • Insert Size (bp)
    347
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer actggcttatcgaaattaatacgactcactatagg
  • 3′ sequencing primer tgggagtggcaccttccagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid is also referenced in the following publication:

Simonich, C. A., McMahon, T. A., Ju, X., Yu, T. C., Brunette, N., Stevens-Ayers, T., Boeckh, M. J., King, N. P., Greninger, A. L., & Bloom, J. D. (2025). RSV F evolution escapes some monoclonal antibodies but does not strongly erode neutralization by human polyclonal sera. bioRxiv. https://doi.org/10.1101/2025.03.11.642476

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRC-CMV-Rev1b was a gift from Jesse Bloom (Addgene plasmid # 204153 ; http://n2t.net/addgene:204153 ; RRID:Addgene_204153)
  • For your References section:

    A pseudovirus system enables deep mutational scanning of the full SARS-CoV-2 spike. Dadonaite B, Crawford KHD, Radford CE, Farrell AG, Yu TC, Hannon WW, Zhou P, Andrabi R, Burton DR, Liu L, Ho DD, Chu HY, Neher RA, Bloom JD. Cell. 2023 Mar 16;186(6):1263-1278.e20. doi: 10.1016/j.cell.2023.02.001. Epub 2023 Feb 13. 10.1016/j.cell.2023.02.001 PubMed 36868218