-
PurposeLentivirus helper plasmid coding for Rev
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204153 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRC
- Total vector size (bp) 5898
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRev
-
SpeciesHIV-1
-
Insert Size (bp)347
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer actggcttatcgaaattaatacgactcactatagg
- 3′ sequencing primer tgggagtggcaccttccagg
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid is also referenced in the following publication:
Simonich, C. A., McMahon, T. A., Ju, X., Yu, T. C., Brunette, N., Stevens-Ayers, T., Boeckh, M. J., King, N. P., Greninger, A. L., & Bloom, J. D. (2025). RSV F evolution escapes some monoclonal antibodies but does not strongly erode neutralization by human polyclonal sera. bioRxiv. https://doi.org/10.1101/2025.03.11.642476
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRC-CMV-Rev1b was a gift from Jesse Bloom (Addgene plasmid # 204153 ; http://n2t.net/addgene:204153 ; RRID:Addgene_204153) -
For your References section:
A pseudovirus system enables deep mutational scanning of the full SARS-CoV-2 spike. Dadonaite B, Crawford KHD, Radford CE, Farrell AG, Yu TC, Hannon WW, Zhou P, Andrabi R, Burton DR, Liu L, Ho DD, Chu HY, Neher RA, Bloom JD. Cell. 2023 Mar 16;186(6):1263-1278.e20. doi: 10.1016/j.cell.2023.02.001. Epub 2023 Feb 13. 10.1016/j.cell.2023.02.001 PubMed 36868218