pAAV-hSyn-miniDq-mCherry-P2A-HA-KORD
(Plasmid
#204359)
-
PurposeAAV vector for coexpression of miniDq and KORD under the control of human synapsin promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204359 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAAV
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameminiDq-mCherry-P2A-HA-KORD
-
Alt namehM3Dq-ICL3_176 KOR DREADD
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3734
-
MutationFor miniDq, the third intracellular loop (ICL3) of hM3Dq was substituted with a 5-amino-acid peptide sequence Q-N-T-I-S derived from hGpr176 ICL3.
- Promoter hSyn
-
Tags
/ Fusion Proteins
- mCherry (for miniDq) (C terminal on insert)
- HA (for KORD) (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer aactccccttcccggccaccttg
- 3′ sequencing primer ctatgttgctccttttacgctatg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAddgene (#44361, #65418, #135391, #51904)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-miniDq-mCherry-P2A-HA-KORD was a gift from Masao Doi (Addgene plasmid # 204359 ; http://n2t.net/addgene:204359 ; RRID:Addgene_204359) -
For your References section:
Size-reduced DREADD derivatives for AAV-assisted multimodal chemogenetic control of neuronal activity and behavior. Miyake T, Tanaka K, Inoue Y, Nagai Y, Nishimura R, Seta T, Nakagawa S, Inoue KI, Hasegawa E, Minamimoto T, Doi M. Cell Rep Methods. 2024 Oct 21;4(10):100881. doi: 10.1016/j.crmeth.2024.100881. 10.1016/j.crmeth.2024.100881 PubMed 39437713