UCK2_Deletion_gRNA_2
(Plasmid
#204673)
-
PurposeDual gRNA plasmid for UCK2 deletion
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204673 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneLentiV_sgRNA_Cas9_GFP
-
Vector typeLentiviral
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameuridine-cytidine kinase 2
-
gRNA/shRNA sequenceCTTCACTAGAGAGTCGCACG ; GTAGAACATCCACTAGACCA
-
SpeciesH. sapiens (human)
-
Entrez GeneUCK2 (a.k.a. TSA903, UK, UMPK)
- Promoter U6
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer Unknown
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
UCK2_Deletion_gRNA_2 was a gift from Jason Sheltzer (Addgene plasmid # 204673 ; http://n2t.net/addgene:204673 ; RRID:Addgene_204673) -
For your References section:
Oncogene-like addiction to aneuploidy in human cancers. Girish V, Lakhani AA, Thompson SL, Scaduto CM, Brown LM, Hagenson RA, Sausville EL, Mendelson BE, Kandikuppa PK, Lukow DA, Yuan ML, Stevens EC, Lee SN, Schukken KM, Akalu SM, Vasudevan A, Zou C, Salovska B, Li W, Smith JC, Taylor AM, Martienssen RA, Liu Y, Sun R, Sheltzer JM. Science. 2023 Jul 6:eadg4521. doi: 10.1126/science.adg4521. 10.1126/science.adg4521 PubMed 37410869