pLenti-SCGB3A2 promoter-EGFP-EF1a-TagRFP
(Plasmid
#204821)
-
PurposeLentiviral vector for human SCGB3A2 promoter-driven expression of EGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204821 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHAGE
- Backbone size w/o insert (bp) 8116
- Total vector size (bp) 8855
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAn upstream region including human SCGB3A2 promoter
-
SpeciesH. sapiens (human)
-
Insert Size (bp)739
-
GenBank IDNM_054023
- Promoter SCGB3A2 promoter
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AATTGAATCCCAGGTTTTTCAAAAGACACT
- 3′ sequencing primer GACAGTTATCTGGGATATTTTTCAGGAGTT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-SCGB3A2 promoter-EGFP-EF1a-TagRFP was a gift from Emma Rawlins (Addgene plasmid # 204821 ; http://n2t.net/addgene:204821 ; RRID:Addgene_204821) -
For your References section:
A human fetal lung cell atlas uncovers proximal-distal gradients of differentiation and key regulators of epithelial fates. He P, Lim K, Sun D, Pett JP, Jeng Q, Polanski K, Dong Z, Bolt L, Richardson L, Mamanova L, Dabrowska M, Wilbrey-Clark A, Madissoon E, Tuong ZK, Dann E, Suo C, Goh I, Yoshida M, Nikolic MZ, Janes SM, He X, Barker RA, Teichmann SA, Marioni JC, Meyer KB, Rawlins EL. Cell. 2022 Dec 8;185(25):4841-4860.e25. doi: 10.1016/j.cell.2022.11.005. 10.1016/j.cell.2022.11.005 PubMed 36493756