pRK5 BMPS WT-TEV-6xHis
(Plasmid
#204837)
-
PurposeMammalian expression of recombinant BMPS WT
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204837 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRK5
- Backbone size w/o insert (bp) 4800
- Total vector size (bp) 6000
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCLN5
-
Alt nameBMPS
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1200
-
Entrez GeneCLN5
- Promoter CMV
-
Tag
/ Fusion Protein
- 6xHis (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer TCCCAGGTCCAACTGCACCTCGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRK5 BMPS WT-TEV-6xHis was a gift from Monther Abu-Remaileh (Addgene plasmid # 204837 ; http://n2t.net/addgene:204837 ; RRID:Addgene_204837) -
For your References section:
The Batten disease gene product CLN5 is the lysosomal bis(monoacylglycero)phosphate synthase. Medoh UN, Hims A, Chen JY, Ghoochani A, Nyame K, Dong W, Abu-Remaileh M. Science. 2023 Sep 15;381(6663):1182-1189. doi: 10.1126/science.adg9288. 10.1126/science.adg9288 PubMed 37708259