pAAV-ITR-PytR(A2.1)-mCherry
(Plasmid
#204869)
-
PurposeExpresses pyrrolysyl tRNA variant "A2.1" and a wild-type mCherry reporter; can be packaged into AAV
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204869 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerCell Biolabs
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 5849
-
Modifications to backboneReplaced GFP with mCherry fluorescent reporter
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameM. mazei pyrrolysyl tRNA mutant "A2.1"
-
Alt nameA2.1
-
Alt nameA2
-
Alt namePytR.A2
-
SpeciesMethanosarcina mazei
-
Insert Size (bp)69
-
MutationU25C; A3G, A4G, T65C, T66C, T67T
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer TTATTTACCTAGGGGTACCTCGGGCAGGAAGAGGGCCTATTTCCCATG
- 3′ sequencing primer GATGTACTGCCAAAACCGCATCACCATGGTAATAGCGATGAC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-ITR-PytR(A2.1)-mCherry was a gift from Abhishek Chatterjee (Addgene plasmid # 204869 ; http://n2t.net/addgene:204869 ; RRID:Addgene_204869) -
For your References section:
Virus-assisted directed evolution of enhanced suppressor tRNAs in mammalian cells. Jewel D, Kelemen RE, Huang RL, Zhu Z, Sundaresh B, Cao X, Malley K, Huang Z, Pasha M, Anthony J, van Opijnen T, Chatterjee A. Nat Methods. 2023 Jan;20(1):95-103. doi: 10.1038/s41592-022-01706-w. Epub 2022 Dec 22. 10.1038/s41592-022-01706-w PubMed 36550276