pAAV-ITR-PytR(PyOtR)-mCherry
(Plasmid
#204870)
-
PurposeExpresses pyrrolysyl tRNA variant "PyOtR" and a wild-type mCherry reporter; can be packaged into AAV
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 204870 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerCell Biolabs
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 5849
-
Modifications to backboneReplaced GFP with mCherry fluorescent reporter
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameM. mazei pyrrolysyl tRNA mutant "PyOtR"
-
Alt namePyOtR
-
Alt nameHTS-25
-
Alt namePytR.PyOTR
-
SpeciesMethanosarcina mazei
-
Insert Size (bp)69
-
MutationU25C; A3G, A4C, A5G, C6G, G63C, T65G, T66C
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer TTATTTACCTAGGGGTACCTCGGGCAGGAAGAGGGCCTATTTCCCATG
- 3′ sequencing primer GATGTACTGCCAAAACCGCATCACCATGGTAATAGCGATGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-ITR-PytR(PyOtR)-mCherry was a gift from Abhishek Chatterjee (Addgene plasmid # 204870 ; http://n2t.net/addgene:204870 ; RRID:Addgene_204870) -
For your References section:
Enhanced Directed Evolution in Mammalian Cells Yields a Hyperefficient Pyrrolysyl tRNA for Noncanonical Amino Acid Mutagenesis. Jewel D, Kelemen RE, Huang RL, Zhu Z, Sundaresh B, Malley K, Pham Q, Loynd C, Huang Z, van Opijnen T, Chatterjee A. Angew Chem Int Ed Engl. 2024 Jan 26:e202316428. doi: 10.1002/anie.202316428. 10.1002/anie.202316428 PubMed 38279536