Skip to main content

pDIV301
(Plasmid #204969)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204969 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAC575
  • Total vector size (bp) 15364
  • Modifications to backbone
    AMA1 element
  • Vector type
    Bacterial Expression, CRISPR ; Fungal expression
  • Selectable markers
    ble (bleomycin resistance marker)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Mad7
  • Species
    Synthetic; codon optimized for A. niger
  • Insert Size (bp)
    3816
  • Promoter Aspergillus nidulans tef1 promoter
  • Tag / Fusion Protein
    • SV40 NLS (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer CTTCTCTGCTCAGCACCTCTACG
  • 3′ sequencing primer GCTTTACGGGAAGAGCTGAGAT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    ble (bleomycin resistance marker)
  • Species
    Streptoalloteichus hindustanus
  • Insert Size (bp)
    375
  • Promoter Aspergillus nidulans trpC promoter

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDIV301 was a gift from Uffe Mortensen (Addgene plasmid # 204969 ; http://n2t.net/addgene:204969 ; RRID:Addgene_204969)
  • For your References section:

    A Mad7 System for Genetic Engineering of Filamentous Fungi. Vanegas KG, Rendsvig JKH, Jarczynska ZD, Cortes MVCB, van Esch AP, Morera-Gomez M, Contesini FJ, Mortensen UH. J Fungi (Basel). 2022 Dec 22;9(1):16. doi: 10.3390/jof9010016. 10.3390/jof9010016 PubMed 36675838