Skip to main content

pET28a-SUPREM
(Plasmid #205023)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205023 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28a
  • Backbone manufacturer
    EMD Biosciences
  • Backbone size w/o insert (bp) 5201
  • Total vector size (bp) 6281
  • Modifications to backbone
    deletion of Nterm His6x-tag and thrombin cleavage site and modifying MCS on Cterm
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SUPer Rna Ecogii Methyltransferase
  • Alt name
    SUPREM
  • Species
    Synthetic
  • Insert Size (bp)
    1080
  • Promoter T7
  • Tag / Fusion Protein
    • His6x tag (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TACGACTCACTATAGGGG
  • 3′ sequencing primer ATGCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET28a-SUPREM was a gift from Paola Laurino (Addgene plasmid # 205023 ; http://n2t.net/addgene:205023 ; RRID:Addgene_205023)
  • For your References section:

    SUPREM: an engineered non-site-specific m6A RNA methyltransferase with highly improved efficiency. Ochiai Y, Clifton BE, Le Coz M, Terenzio M, Laurino P. Nucleic Acids Res. 2024 Oct 17:gkae887. doi: 10.1093/nar/gkae887. 10.1093/nar/gkae887 PubMed 39417589