pET28a-SUPREM
(Plasmid
#205023)
-
PurposeExpressing SUPer Rna Ecogii Methyltransferase (SUPREM)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 205023 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a
-
Backbone manufacturerEMD Biosciences
- Backbone size w/o insert (bp) 5201
- Total vector size (bp) 6281
-
Modifications to backbonedeletion of Nterm His6x-tag and thrombin cleavage site and modifying MCS on Cterm
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSUPer Rna Ecogii Methyltransferase
-
Alt nameSUPREM
-
SpeciesSynthetic
-
Insert Size (bp)1080
- Promoter T7
-
Tag
/ Fusion Protein
- His6x tag (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TACGACTCACTATAGGGG
- 3′ sequencing primer ATGCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-SUPREM was a gift from Paola Laurino (Addgene plasmid # 205023 ; http://n2t.net/addgene:205023 ; RRID:Addgene_205023) -
For your References section:
SUPREM: an engineered non-site-specific m6A RNA methyltransferase with highly improved efficiency. Ochiai Y, Clifton BE, Le Coz M, Terenzio M, Laurino P. Nucleic Acids Res. 2024 Oct 17:gkae887. doi: 10.1093/nar/gkae887. 10.1093/nar/gkae887 PubMed 39417589