Skip to main content

Integrin β4-GFP
(Plasmid #205092)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205092 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 10130
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Integrin beta 4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5445
  • Entrez Gene
    ITGB4 (a.k.a. CD104, GP150, JEB5A, JEB5B)
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer gatccgctagcgtttaaacgggccctctagac
  • 3′ sequencing primer ccgcggtaccgaagtttggaagaactgttggtcc
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The DNA fragment encoding integrin beta 4 was amplified from pcDNA3.1/Myc-His beta4, a gift from Filippo Giancotti (Addgene plasmid # 16039).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Integrin β4-GFP was a gift from Bianxiao Cui (Addgene plasmid # 205092 ; http://n2t.net/addgene:205092 ; RRID:Addgene_205092)
  • For your References section:

    Curved adhesions mediate cell attachment to soft matrix fibres in three dimensions. Zhang W, Lu CH, Nakamoto ML, Tsai CT, Roy AR, Lee CE, Yang Y, Jahed Z, Li X, Cui B. Nat Cell Biol. 2023 Sep 28. doi: 10.1038/s41556-023-01238-1. 10.1038/s41556-023-01238-1 PubMed 37770566