Integrin β4-GFP
(Plasmid
#205092)
-
PurposeExpress GFP-tagged human integrin β4 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205092 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepEGFP-C1
- Backbone size w/o insert (bp) 4731
- Total vector size (bp) 10130
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameIntegrin beta 4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5445
-
Entrez GeneITGB4 (a.k.a. CD104, GP150, JEB5A, JEB5B)
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer gatccgctagcgtttaaacgggccctctagac
- 3′ sequencing primer ccgcggtaccgaagtttggaagaactgttggtcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe DNA fragment encoding integrin beta 4 was amplified from pcDNA3.1/Myc-His beta4, a gift from Filippo Giancotti (Addgene plasmid # 16039).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Integrin β4-GFP was a gift from Bianxiao Cui (Addgene plasmid # 205092 ; http://n2t.net/addgene:205092 ; RRID:Addgene_205092) -
For your References section:
Curved adhesions mediate cell attachment to soft matrix fibres in three dimensions. Zhang W, Lu CH, Nakamoto ML, Tsai CT, Roy AR, Lee CE, Yang Y, Jahed Z, Li X, Cui B. Nat Cell Biol. 2023 Sep 28. doi: 10.1038/s41556-023-01238-1. 10.1038/s41556-023-01238-1 PubMed 37770566