Lenti-DAG1
(Plasmid
#205149)
-
PurposeOverexpress DAG1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205149 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerFeng Zhang
- Backbone size w/o insert (bp) 8430
- Total vector size (bp) 11115
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDystroglycan 1
-
Alt nameDAG1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2685
-
MutationCarries common missense variant c.41C>G (p.Ser14Trp)
-
GenBank IDNM_004393
-
Entrez GeneDAG1 (a.k.a. 156DAG, A3a, AGRNR, DAG, LGMDR16, MDDGA9, MDDGC7, MDDGC9)
- Promoter EF-1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer aaccgtatataagtgcagtagtcg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Lenti-DAG1 was a gift from Monkol Lek (Addgene plasmid # 205149 ; http://n2t.net/addgene:205149 ; RRID:Addgene_205149)