Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #154951)


Item Catalog # Description Quantity Price (USD)
Plasmid 154951 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter human synapsin
  • Tag / Fusion Protein
    • soma-targeting motif from Kv2.1 channel (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site HindIII (destroyed during cloning)
  • 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
  • 3′ sequencing primer TGTTGCTCCTTTTACGCTATG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The insert contains the fluorescence tag mCerulean3 in between the 2 channelrhodopsins (C-terminal of GtACR2) . Please visit for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hSyn-DIO-somBiPOLES-mCerulean was a gift from Simon Wiegert (Addgene plasmid # 154951 ; ; RRID:Addgene_154951)
  • For your References section:

    BiPOLES: a tool for bidirectional dual-color optogenetic control of neurons. Vierock J, Rodriguez-Rozada S, Pieper F, Dieter A, Bergs A, Zeitzschel N, Ahlbeck J, Sauter K, Gottschalk A, Engel AK, Hegemann P, Wiegert JS. bioRxiv (2020) 10.1101/2020.07.15.204347