MARS-nGFP
(Plasmid
#205234)
-
PurposeExpresses PLEKHA5 aa 143-271 (K163A and R164A) fused to a HA-tagged GFP nanobody in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 205234 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonemScarlet-i-N1
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5585
-
Modifications to backboneAdded a nuclear export signal downstream of mScarlet-i
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePLEKHA5 aa 143-271 (K163A and R164A) fused to a HA-tagged GFP nanobody
-
Alt namePEPP2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)858
-
Mutationamino acids 143-271 of PLEKHA5 (GenBank reference sequence NM_001256470.2) with K163A and R164A mutations
-
GenBank IDNM_001256470.2
-
Entrez GenePLEKHA5 (a.k.a. PEPP-2, PEPP2)
- Promoter CMV
-
Tags
/ Fusion Proteins
- HA (C terminal on insert)
- nGFP (GFP nanobody) (C terminal on insert)
- mScarlet-i (C terminal on backbone)
- Nuclear Export Sequence (C terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV forward
- 3′ sequencing primer EGFPC1R (CATTTTATGTTTCAGGTTCAGGG)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MARS-nGFP was a gift from Jeremy Baskin (Addgene plasmid # 205234 ; http://n2t.net/addgene:205234 ; RRID:Addgene_205234) -
For your References section:
A phosphorylation-controlled switch confers cell cycle-dependent protein relocalization. Cao X, Huang S, Wagner MM, Cho YT, Chiu DC, Wartchow KM, Lazarian A, McIntire LB, Smolka MB, Baskin JM. Nat Cell Biol. 2024 Oct;26(10):1804-1816. doi: 10.1038/s41556-024-01495-8. Epub 2024 Aug 29. 10.1038/s41556-024-01495-8 PubMed 39209962