pCDH-2xMARS-nGFP-puro
(Plasmid
#205238)
-
PurposeLentiviral vector encoding two repeats of PLEKHA5 aa 143-271 (K163A and R164A) fused to a HA-tagged GFP nanobody
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205238 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCDH-CMV-MCS-EF1-Puro
- Backbone size w/o insert (bp) 7368
- Total vector size (bp) 9427
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name2xPLEKHA5(143-271)-K163A/R164A-HA-nGFP
-
Alt namePEPP2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1293
-
Mutationamino acids 143-271 of PLEKHA5 (GenBank reference sequence NM_001256470.2) with K163A and R164A mutations
-
GenBank IDNM_001256470.2
-
Entrez GenePLEKHA5 (a.k.a. PEPP-2, PEPP2)
- Promoter CMV
-
Tags
/ Fusion Proteins
- HA (C terminal on insert)
- nGFP (GFP nanobody) (C terminal on insert)
- mScarlet-i (C terminal on insert)
- Nuclear Export Sequence (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV forward
- 3′ sequencing primer pCDH-Rev (tcggcaattgaacgggtgcctaga) (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-2xMARS-nGFP-puro was a gift from Jeremy Baskin (Addgene plasmid # 205238 ; http://n2t.net/addgene:205238 ; RRID:Addgene_205238)