Skip to main content

pC1.530
(Plasmid #205441)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205441 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    n/a
  • Total vector size (bp) 6420
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RepB gRNA
  • gRNA/shRNA sequence
    ttaataaatatagtttaagtaa
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

11901 toolkit compatible with CyanoGate Kit

Please note: The GmR cassette has a 19 bp deletion near the beginning of the CDS but is still functional.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pC1.530 was a gift from Alistair McCormick (Addgene plasmid # 205441 ; http://n2t.net/addgene:205441 ; RRID:Addgene_205441)
  • For your References section:

    A toolbox to engineer the highly productive cyanobacterium Synechococcus sp. PCC 11901. Victoria AJ, Selao TT, Moreno-Cabezuelo JA, Mills LA, Gale GAR, Lea-Smith DJ, McCormick AJ. Plant Physiol. 2024 May 7:kiae261. doi: 10.1093/plphys/kiae261. 10.1093/plphys/kiae261 PubMed 38713768