Skip to main content
Addgene

pAAV-CMV-flex-Unc5cHA-WPRE-SV40pA
(Plasmid #205442)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205442 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAAV
  • Total vector size (bp) 7526
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Unc5c
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2793
  • Entrez Gene
    Unc5c (a.k.a. B130051O18Rik, Unc5h3, rcm)
  • Promoter mini-CMV (with MVM small intron)
  • Tag / Fusion Protein
    • 3xHA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer TGGAGCACCTGCCTGAAATCACTT
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Unc5c cDNA was provided by Dr. Woj Wojtowicz (UC Berkeley). Other plasmid components provided by Dr. Boris Kantor (Duke University).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2022.08.29.505771 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CMV-flex-Unc5cHA-WPRE-SV40pA was a gift from Jeremy Kay (Addgene plasmid # 205442 ; http://n2t.net/addgene:205442 ; RRID:Addgene_205442)
  • For your References section:

    Rejection of inappropriate synaptic partners in mouse retina mediated by transcellular FLRT2-UNC5 signaling. Prigge CL, Dembla M, Sharma A, El-Quessny M, Kozlowski C, Paisley CE, Miltner AM, Johnson TM, Della Santina L, Feller MB, Kay JN. Dev Cell. 2023 Oct 23;58(20):2080-2096.e7. doi: 10.1016/j.devcel.2023.07.011. Epub 2023 Aug 8. 10.1016/j.devcel.2023.07.011 PubMed 37557174